Text Book Back Questions and Answers - Chapter 5 Molecular Genetics 12th Biology Zoology Guide Samacheer Kalvi Solutions
Updated On 26-08-2025 By Lithanya
You can Download the Text Book Back Questions and Answers - Chapter 5 Molecular Genetics 12th Biology Zoology Guide Samacheer Kalvi Solutions with expert answers for all chapters. Perfect for Tamil & English Medium students to revise the syllabus and score more marks in board exams. Download and share it with your friends
Share this to Friend on WhatsApp
Molecular Genetics
Text Book Back Questions and Answers
Question 1.
Hershey and Chase experiment with bacteriophage showed that
(a) Protein gets into the bacterial cells
(b) DNA is the genetic material
(c) DNA contains radioactive sulphur
(d) Viruses undergo transformation
Answer:
(b) DNA is the genetic material
Question 2.
DNA and RNA are similar with respect to
(a) Thymine as a nitrogen base
(b) A single-stranded helix shape
(c) Nucleotide containing sugars, nitrogen bases and phosphates
(d) The same sequence of nucleotides for the amino acid phenyl alanine
Answer:
(c) Nucleotide containing sugars, nitrogen bases and phosphates
Question 3.
A mRNA molecule is produced by
(a) Replication
(b) Transcription
(c) Duplication
(d) Translation
Answer:
(b) Transcription
Question 4.
The total number of nitrogenous bases in human genome is estimated to be about
(a) 3.5 million
(b) 35000
(c) 35 million
(d) 3.1 billion
Answer:
(d) 3.1 billion
Question 5.
E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?
(a) One high and one low density band
(b) One intermediate density band
(c) One high and one intermediate density band
(d) One low and one intermediate density band
Answer:
(d) One low and one intermediate density band
Question 6.
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
(a) Origin of replication occurs only at the 5’ end of the molecules
(b) DNA ligase works only in the 3’ → 5’ direction
(c) DNA polymerase can join new nucleotides only to the 3 ’ end of the growing stand
(d) Helicases and single-strand binding proteins that work at the 5’ end
Answer:
(d) Helicases and single-strand binding proteins that work at the 5’ end
Question 7.
Which of the following is the correct sequence of event with reference to the central dogma?
(a) Transcription, Translation, Replication
(b) Transcription, Replication, Translation
(c) Duplication, Translation, Transcription
(d) Replication, Transcription, Translation
Answer:
(d) Replication, Transcription, Translation
Question 8.
Which of the following statements about DNA replication is not correct?
(a) Unwinding of DNA molecule occurs as hydrogen bonds break
(b) Replication occurs as each base is paired with another exactly like it
(c) Process is known as semi – conservative replication because one old strand is conserved in the new molecule
(d) Complementary base pairs are held together with hydrogen bonds
Answer:
(b) Replication occurs as each base is paired with another exactly like it
Question 9.
Which of the following statements is not true about DNA replication in eukaryotes?
(a)) Replication begins at a single origin of replication.
(b) Replication is bidirectional from the origins.
(c) Replication occurs at about 1 million base pairs per minute.
(d) There are numerous different bacterial chromosomes, with replication occurring in each at the same time.
Answer:
(d) There are numerous different bacterial chromosomes, with replication occurring in each at the same time.
Question 10.
The first codon to be deciphered was which codes for
(a) AAA, proline
(b) GGG, alanine
(c) UUU, Phenylalanine
(d) TTT, arginine
Answer:
(c) UUU, Phenylalanine
Question 11.
Meselson and Stahl’s experiment proved __________
(a) Transduction
(b) Transformation
(c) DNA is the genetic material
(d) Semi-conservative nature of DNA replication
Answer:
(d) Semi-conservative nature of DNA replication
Question 12.
Ribosomes are composed of two subunits; the smaller subunit of a ribosome has a binding site for and the larger subunit has two binding sites for two
Answer:
mRNA, tRNA
Question 13.
Anoperonisa:
(a) Protein that suppresses gene expression
(b) Protein that accelerates gene expression
(c) Cluster of structural genes with related function
(d) Gene that switched other genes on or off
Answer:
(d) Gene that switched other genes on or off
Question 14.
When lactose is present in the culture medium:
(a) Transcription of lacy, lac z, lac a genes occurs
(b) Repressor is unable to bind to the operator
(c) Repressor is able to bind to the operator
(d) Both (a) and (b) are correct
Answer:
(d) Both (a) and (b) are correct
Question 15.
Give reasons: Genetic code is ‘universal’.
Answer:
The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However similarities are more common than differences.
Question 16.
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
Answer:

Question 17.
Differentiate – Leading strand and lagging strand
Answer:
1. DNA polymerase I Involved DNA repair mechanism
2. DNA polymerase II Involved DNA repair mechanism
3. DNA polymerase III Involved in DNA replicaton
Question 18.
Differentiate – Template strand and coding strand.
Answer:
1. Template Strand: During replication, DNA strand having the polarity 3’ → 5’ act as template strand.
2. Coding Strand: During replication, DNA strand having the polarity 5’ → 3’ act as coding strand.
Question 19.
Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.
Answer:
Scientists have identified about 1.4 million locations, where single base DNA differences (SNPs – Single nucleotide polymorphism – pronounced as ‘snips’) occur in humans. Identification of ‘SNIPS’ is helpful in finding chromosomal locations for disease associated sequences and tracing human history.
Question 20.
State any three goals of the human genome project.
Answer:
1. Identify all the genes (approximately 30000) in human DNA.
2. Determine the sequence of the three billion chemical base pairs that makeup the human DNA.
3. To store this information in databases.
Question 21.
In E.coli, three enzymes 0- galactosidase, permease and transacetylase are produced in the presence of lactose. Explain why the enzymes are not synthesized in the absence of lactose.
Answer:
In the absence of lactose, the repressor protein binds to the operator and prevents the transcription of structural gene by RNA polymerase, hence the enzymes are not produced. However, there will always be a minimal level of lac operon expression even in absence of lactose.
Question 22.
Distinguish between structural gene, regulatory gene and operator gene.
Answer:
Structure of the operon: Each operon is a unit of gene expression and regulation and consists of one or more structural genes and an adjacent operator gene that controls transcriptional, activity of the structural gene.
1. The structural gene codes for proteins, rRNA and tRNA required by the cell.
2. Promoters are the signal sequences in DNA that initiate RNA synthesis. RNA polymerase binds to the promoter prior to the initiation of transcription.
3. The operators are present between the promoters and structural genes. The repressor protein binds to the operator region of the operon.
Question 23.
A low level of expression of lac operon occurs at all the time in E-coli. Justify the statement.
Answer:
One of the enzyme synthesized by lac operon is permease which is involved in the transport of lactose into the cells. If the lac operon gets inactivated, permease is not synthesized hence lactose cannot enter the cell. Lactose acts as a inducer, binding to the repressor protein and switch on the operator to initiate gene expression.
Question 24.
Why the human genome project is called a mega project?
Answer:
The international human genome project was launched in the year 1990. It was a mega project and took 13 years to complete. The human genome is about 25 times larger than the genome of any organism sequenced to date and is the first vertebrate genome to be completed. Human genome is said to have approximately 3 >109 bp. HGP was closely associated with the rapid development of a new area in biology called bioinformatics.
Question 25.
From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability and mutation?
Answer:
Inference of Watson and Crick on DNA replication: They concluded that each of the DNA strand in a helix act as template during DNA replication leading to formation of new daughter DNA molecules, which are complementary to parental strand, (i.e., Semi-conservative method of replication) Inference on coding capability: During transcription, the genetic information in the DNA strand is coded to mRNA as complementary bases, (except for uracil in place of thymine in RNA) Inference on mutation: Any changes in the nucleotide sequence of DNA leads to corresponding alteration in aminoacid sequence of specific protein thus confirming the validity of genetic code.
Question 26.
Why tRNA is called an adapter molecule?
Answer:
The transfer RNA, (tRNA) molecule of a cell acts as a vehicle that picks up the amino acids scattered through the cytoplasm and also reads specific codes of mRNA molecules. Hence it is called an adapter molecule. This term was postulated by Francis Crick.
Question 27.
What are the three structural differences between RNA and DNA?
Answer:
DNA:
1. Sugar is deoxyribose sugar.
2. Double stranded structure.
3. Nitrogen bases are Adenine, Guanine, Cytosine and Thymine.
RNA:
1. Sugar is ribose sugar.
2. Single stranded molecule.
3. Nitrogen bases are Adenine, Guanine, Cytosine and Uracil.
Question 28.
Name the anticodon required to recognize the following codons:
AAU, CGA, UAU, and GCA.
Answer:
UUA, GCU, AUA and CGU.
Question 29.
(a) Identify the figure given below
(b) Redraw the structure as a replicating fork and label the parts
(c) Write the source of energy for this replication and name the enzyme involved in this process.
(d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Answer:
(a) Replication fork
(b)

(c) Deoxy nucleotide, triphosphate acts as a energy source for replication. DNA polymerase is used for replication
(d) mRNA contacting information for protein synthesis will developed from DNA strand having polariy 5’ → 3’
Question 30.
If the coding sequence in a transcription unit is written as follows:
5’ TGCATGCATGCATGCATGCATGCATGC 3’
Write down the sequence of mRNA.
Answer:
mRNA sequence is 3’ACGUACGUACGUUCGUACGUACGUACG5’
Question 31.
How is the two stage process of protein synthesis advantageous?
Answer:
The split gene feature of eukaryotic genes is almost entirely absent in prokaryotes. Originally each exon may have coded for a single polypeptide chain with a specific function. Since exon arrangement and intron removal are flexible, the exon coding for these polypeptide subunits act as domains combining in various ways to form new genes. Single genes can produce different functional proteins by arranging their exons in several different ways through alternate splicing patterns, a mechanism known to play an important role in generating both protein and functional diversity in animals. Introns would have arosen before or after the evolution of eukaryotic gene.
If introns arose late how did they enter eukaryotic gene? Introns are mobile DNA sequences that can splice themselves out of, as well as into, specific ‘target sites’ acting like mobile transposon-like elements (that mediate transfer of genes between organisms – Horizontal Gene Transfer – HGT). HGT occurs between lineages of prokaryotic cells, or from prokaryotic to eukaryotic cells and between eukaryotic cells. HGT is now hypothesized to have played a major role in the evolution of life on Earth.
Question 32.
Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen?
Answer:
Generally proteins contain sulphur but not phosphorous and nucleic acid (DNA) contains , phosphorous but not sulphur. Hence Hershey – Chase used radioactive isotopes of sulphur (35S) and phosphorus (32P) to keep separate track of viral protein and nucleic acid in culture medium. The expected result cannot be achieved, if radioactive carbon and nitrogen is used, since these molecules are present in both DNA and proteins.
Question 33.
Explain the formation of a nucleosome.
Answer:
Komberg proposed a model for the nucleosome, in which 2 molecules of the four histone proteins H2A, H2B, H3 and H4 are organized to form a unit of eight molecules called histone octamere.
The negatively charged DNA is wrapped around the positively charged histone octamere to form a structure called nucleosome. A typical nucleosome contains 200 bp of DNA helix. The histone octameres are in close contact and DNA is coiled on the outside of nucleosome.

Question 34.
It is established that RNA is the first genetic material. Justify giving reasons.
Answer:
Three molecular biologists in the early 1980’s (Leslie Orgel, Francis Brick and Carl Woese) independently proposed the ‘RNA world’ as the first stage in the evolution of life, a stage when RNA catalysed all molecules necessary for survival and replication. The term ‘RNA world’ first used by Walter Gilbert in 1986, hypothesizes RNA as the first genetic on Earth. There is now enough evidence to suggest that essential life processes (such as metabolism, translation and splicing etc.,) evolved around RNA. RNA has the ability to act as both genetic material and catalyst. There are several biochemical reactions in living systems that are catalysed by RNA. This catalytic RNA is known as ribozyme. But, RNA being a catalyst was reactive and hence unstable.
This led to evolution of a more stable form of DNA, with certain chemical modifications. Since DNA is a double stranded molecule having complementary strand, it has resisted changes by evolving a process of repair. Some RNA molecules function as gene regulators by binding to DNA and affect gene expression. Some viruses use RNA as the genetic material. Andrew Fire and Craig Mellow (recipients of Nobel Prize in 2006) were of the opinion that RNA is an active ingredient in the chemistry of life.
